genomics suite (software analysis microarray data Search Results


99
Toyobo revertra acetm qpcr rt master mix
Exploration of PCIF1 target genes by genome-wide gene expression analysis. ( A ) <t>RT-qPCR</t> analysis of total RNAs isolated from HeLa cells treated with control siRNA (siNC) or two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #2). ( B ) Immunoblotting analysis of total protein extracts from HeLa cells treated with control siRNA (siNC) and two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #2) with anti-PCIF1 and anti-b-actin antibodies. ( C , D ) Venn diagrams showing the overlap between the two indicated siRNA-mediated downregulated ( C ) and upregulated ( D ) genes identified by the gene expression profile analyzed by DNA microarray using a Human Genome U133 Plus 2.0 Array (Affymetrix). The condition for selecting differentially expressed genes are as follows: (1) cut-off condition: expression > 100, (2) fold change: >2, (3) p -value < 0.05.
Revertra Acetm Qpcr Rt Master Mix, supplied by Toyobo, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genomics+suite+(software+analysis+microarray+data/ReverTra+Ace+qPCR+RT+Master+Mix+with+gDNA+Remover/pmc11506431-83-89-98
Average 99 stars, based on 1 article reviews
revertra acetm qpcr rt master mix - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

96
Jackson Immuno donkey anti mouse cy3
mRNA expression analysis in Nf1 mutant mouse Schwann cells. (A) Microarray analysis was used to compare genome-wide expression levels between normal mouse Schwann cells and Nf1 mutant Schwann cells. The control for each comparison was <t>Cy3-labeled</t> cDNA generated from normal mouse Schwann cell mRNA. For each of four Nf1 mutant Schwann cell samples (Nf1+/−, Nf1−/−, Nf1−/− TXF, and Nf1−/− TXF treated with FTI), mRNA was used as a template to synthesize Cy5-labeled cDNA. Cy3- and Cy5-labeled cDNA probes were hybridized simultaneously to the Incyte Genomics MouseGEM 1.0 cDNA microarray. Relative intensities of Cy3 versus Cy5 fluorescent signals for each cDNA target sequence were analyzed with GeneSpring software. The most changes were observed in the Nf1−/− TXF cells (genes upregulated in Nf1−/− TXF are red; genes downregulated in Nf1−/− TXF are green). Expression of one target cDNA, BLBP (black line), was 26-fold above normal in the Nf1−/− TXF cells and not normalized by FTI treatment. (B) RT-PCR analysis confirmedthe microarray result of elevated BLBP expression in Nf1−/− TXF cells. Reverse transcriptase (RT) was omitted from duplicate samples to control for DNA contamination. Primers for BLBP (∼200-bp amplicon) and actin control primers (∼500-bp amplicon) were included in the mixture for each 40-cycle reaction. The plasmid positive control for BLBP amplification is the UniGEM clone (Incyte Genomics) containing the BLBP cDNA insert spotted on the microarray. (C) Quantitative real-time PCR of BLBP normalized to GAPDH resulted in a 145-fold change over expression in Nf1−/− TXF cells compared to wild-type mouse Schwann cells. Rn, fluorescent signal intensity; horizontal starred line, chosen threshold at geometric phase of amplification.
Donkey Anti Mouse Cy3, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genomics+suite+(software+analysis+microarray+data/Donkey+Anti-Mouse+IgG/pmc00149461-163-18-23
Average 96 stars, based on 1 article reviews
donkey anti mouse cy3 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

sw480  (ATCC)
99
ATCC sw480
( a ) Cell proliferation and ( b ) cell viability alterations of HT-29 and <t>SW480</t> colorectal cancer cell lines following different folic acid (FA) supplies. Sulforhodamine B (SRB) was used for cell proliferation detection (* p ≤ 0.05, *** p ≤ 0.001), while cell viability data were obtained by alamarBlue assay (** p ≤ 0.01). FA-depleted cells were kept in media containing 0 ng/mL FA, whereas treated cells were exposed to 100 and 10,000 ng/mL FA for 72 h. The percentages of cell proliferation and viability were given relative to samples kept in the normal growth media. FA: folic acid.
Sw480, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genomics+suite+(software+analysis+microarray+data/SW480/pmc08997840-42-4-5
Average 99 stars, based on 1 article reviews
sw480 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier


94
Santa Cruz Biotechnology rabbit polyclonal anti tiam1 c 16
KEY RESOURCES TABLE
Rabbit Polyclonal Anti Tiam1 C 16, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genomics+suite+(software+analysis+microarray+data/Tiam1+Antibody/pmc05445660-11-0-5
Average 94 stars, based on 1 article reviews
rabbit polyclonal anti tiam1 c 16 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

96
Miltenyi Biotec human gm csf
KEY RESOURCES TABLE
Human Gm Csf, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genomics+suite+(software+analysis+microarray+data/Human+GM-CSF%2C+research+grade/pmc05445660-43-0-3
Average 96 stars, based on 1 article reviews
human gm csf - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

a172  (ATCC)
97
ATCC a172
Transcriptional silencing of NSUN5 by promoter CpG island hypermethylation in human glioma cells. a Percentage of NSUN5 methylation in the Sanger panel of cancer cell lines by tumor type. b NSUN5 methylation is associated with loss of the transcript in the glioma cell lines from Sanger ( n = 48). Correlation analysis between methylation beta values and expression Z -score are shown. The P value corresponding to Spearman’s rank correlation test and the associated rho coefficient are indicated in the figure. c Bisulfite genomic sequencing of NSUN5 promoter CpG Island in glioma cells lines and brain white matter. CpG dinucleotides are represented as short vertical lines and the transcription start site (TSS) is represented as a long black arrow. Single clones are shown for each sample. Presence of an unmethylated or methylated cytosine is indicated by a white or black square, respectively, and percentage of methylation is indicated on the right. d DNA methylation profile of the CpG island promoter for the NSUN5 gene analyzed by the 450 K DNA methylation microarray. Single CpG absolute methylation levels (0–1) are shown. Green, unmethylated; red, methylated. Data from the studied six glioma cell lines, brain white matter and nineteen normal brain samples are shown. e NSUN5 expression levels in glioma cell lines determined by real-time PCR (data shown represent mean ± S.D. of biological triplicates) and western blot. f Expression of the NSUN5 RNA transcript and protein was restored in the <t>A172,</t> LN229 and KS-1 cells by treatment with the demethylating drug 5-aza-2′-deoxycytidine (AZA). Data shown represent the mean ± S.D. of biological triplicates and P values were obtained by the Mann–Whitney test. ** P < 0.01
A172, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genomics+suite+(software+analysis+microarray+data/A-172/pmc06851045-17-6-13
Average 97 stars, based on 1 article reviews
a172 - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

99
New England Biolabs epicentre end it dna end repair da addition neb da tailing kit
Genome-wide analyses on HIV latency models
Epicentre End It Dna End Repair Da Addition Neb Da Tailing Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genomics+suite+(software+analysis+microarray+data/Endonuclease+III/pmc04369283-8-18-25
Average 99 stars, based on 1 article reviews
epicentre end it dna end repair da addition neb da tailing kit - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

92
Addgene inc pkd1flox flox ksp cre shibazaki
Genome-wide analyses on HIV latency models
Pkd1flox Flox Ksp Cre Shibazaki, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genomics+suite+(software+analysis+microarray+data/pEF+1-PSN-4+(Plasmid+%2320084)/pm38039961-533-113-107
Average 92 stars, based on 1 article reviews
pkd1flox flox ksp cre shibazaki - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

90
Kurabo industries microarray analysis suite software transcriptome viewer
Genome-wide analyses on HIV latency models
Microarray Analysis Suite Software Transcriptome Viewer, supplied by Kurabo industries, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genomics+suite+(software+analysis+microarray+data/transcriptome+viewer/pm37231861-94-21-27
Average 90 stars, based on 1 article reviews
microarray analysis suite software transcriptome viewer - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

86
Partek genomics suite
Genome-wide analyses on HIV latency models
Genomics Suite, supplied by Partek, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genomics+suite+(software+analysis+microarray+data/flow+partek+software/10__4161_slash_rna__21378-216-8-7
Average 86 stars, based on 1 article reviews
genomics suite - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

96
Bio-Rad sureprintg3 mouse genome cgh microarray kit
Key resources table
Sureprintg3 Mouse Genome Cgh Microarray Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genomics+suite+(software+analysis+microarray+data/Trans-Blot+Turbo+Mini+PVDF+Transfer+Packs/pmc10469541-395-14-7
Average 96 stars, based on 1 article reviews
sureprintg3 mouse genome cgh microarray kit - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

Image Search Results


Exploration of PCIF1 target genes by genome-wide gene expression analysis. ( A ) RT-qPCR analysis of total RNAs isolated from HeLa cells treated with control siRNA (siNC) or two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #2). ( B ) Immunoblotting analysis of total protein extracts from HeLa cells treated with control siRNA (siNC) and two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #2) with anti-PCIF1 and anti-b-actin antibodies. ( C , D ) Venn diagrams showing the overlap between the two indicated siRNA-mediated downregulated ( C ) and upregulated ( D ) genes identified by the gene expression profile analyzed by DNA microarray using a Human Genome U133 Plus 2.0 Array (Affymetrix). The condition for selecting differentially expressed genes are as follows: (1) cut-off condition: expression > 100, (2) fold change: >2, (3) p -value < 0.05.

Journal: Cells

Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity

doi: 10.3390/cells13201689

Figure Lengend Snippet: Exploration of PCIF1 target genes by genome-wide gene expression analysis. ( A ) RT-qPCR analysis of total RNAs isolated from HeLa cells treated with control siRNA (siNC) or two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #2). ( B ) Immunoblotting analysis of total protein extracts from HeLa cells treated with control siRNA (siNC) and two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #2) with anti-PCIF1 and anti-b-actin antibodies. ( C , D ) Venn diagrams showing the overlap between the two indicated siRNA-mediated downregulated ( C ) and upregulated ( D ) genes identified by the gene expression profile analyzed by DNA microarray using a Human Genome U133 Plus 2.0 Array (Affymetrix). The condition for selecting differentially expressed genes are as follows: (1) cut-off condition: expression > 100, (2) fold change: >2, (3) p -value < 0.05.

Article Snippet: An amount of 1.5 μg of anti-m 6 A antibody (Abcam Limited, Cambridge, UK, ab151230) or normal rabbit IgG (Medical & Biological Laboratories Co.) was incubated with 30 μL of Dynabeads Protein G (Thermo Fisher Scientific) at room temperature for 1 h. Total RNA (50 μg) was added to the antibody-Dynabead complexes and incubated at 4 °C for 4 h. After washing three times, the bound RNA was purified from the beads using SepasolTM-RNA I Super G. The first strand of cDNA was synthesized from m 6 A-RNA using ReverTra AceTM qPCR RT Master Mix with gDNA Remover (Toyobo Co., Osaka, Japan) with random hexamer primers according to the manufacturer’s instructions. cDNA was quantified using GeneAce SYBRTM qPCR Mix II (Nippon Gene Co., Tokyo, Japan) and a Mx3000P real-time PCR system (Agilent).

Techniques: Genome Wide, Gene Expression, Quantitative RT-PCR, Isolation, Control, Western Blot, Microarray, Expressing

Expression of RAB23 and CNOT6 is regulated by PCIF1 at both the mRNA and protein levels. ( A – C ) RT-qPCR analysis of total RNAs isolated from HeLa cells treated with control siRNA (siNC) and two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #3), using the specific primer set detecting PCIF1 ( A ), RAB23 ( B ), and CNOT6 ( C ) expression. ( D , E ) Immunoblotting analysis of total protein extracts from HeLa cells treated with control siRNA (siNC) and two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #3) with the indicated antibodies. Signal intensities obtained from immunoblotting were quantified using ImageJ software version 1.52. The y-axis represents the fold change relative to the levels in HeLa cells treated with control siRNA. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between the control siRNA treatment and the indicated PCIF1-targeted siRNA (Student’s t -test, * p < 0.05, ** p < 0.01, *** p < 0.001).

Journal: Cells

Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity

doi: 10.3390/cells13201689

Figure Lengend Snippet: Expression of RAB23 and CNOT6 is regulated by PCIF1 at both the mRNA and protein levels. ( A – C ) RT-qPCR analysis of total RNAs isolated from HeLa cells treated with control siRNA (siNC) and two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #3), using the specific primer set detecting PCIF1 ( A ), RAB23 ( B ), and CNOT6 ( C ) expression. ( D , E ) Immunoblotting analysis of total protein extracts from HeLa cells treated with control siRNA (siNC) and two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #3) with the indicated antibodies. Signal intensities obtained from immunoblotting were quantified using ImageJ software version 1.52. The y-axis represents the fold change relative to the levels in HeLa cells treated with control siRNA. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between the control siRNA treatment and the indicated PCIF1-targeted siRNA (Student’s t -test, * p < 0.05, ** p < 0.01, *** p < 0.001).

Article Snippet: An amount of 1.5 μg of anti-m 6 A antibody (Abcam Limited, Cambridge, UK, ab151230) or normal rabbit IgG (Medical & Biological Laboratories Co.) was incubated with 30 μL of Dynabeads Protein G (Thermo Fisher Scientific) at room temperature for 1 h. Total RNA (50 μg) was added to the antibody-Dynabead complexes and incubated at 4 °C for 4 h. After washing three times, the bound RNA was purified from the beads using SepasolTM-RNA I Super G. The first strand of cDNA was synthesized from m 6 A-RNA using ReverTra AceTM qPCR RT Master Mix with gDNA Remover (Toyobo Co., Osaka, Japan) with random hexamer primers according to the manufacturer’s instructions. cDNA was quantified using GeneAce SYBRTM qPCR Mix II (Nippon Gene Co., Tokyo, Japan) and a Mx3000P real-time PCR system (Agilent).

Techniques: Expressing, Quantitative RT-PCR, Isolation, Control, Western Blot, Software, Standard Deviation

Ectopic expression of siRNA-resistant PCIF1 restores the normal levels of target mRNA expression. ( A , B ) RT-qPCR analysis of total RNAs isolated from HeLa cells transfected with a control empty vector (Vec) or a vector expressing siRNA-resistant PCIF1 (PCIF1siR) under treatment with control siRNA (siNC) or PCIF1-targeted siRNAs (siPCIF1 #3), using the specific primer set detecting RAB23 ( A ) and CNOT6 ( B ) expression. The y -axis represents the fold change relative to the levels in HeLa cells treated with control siRNA. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between indicated pairs (Student’s t -test, *** p < 0.001).

Journal: Cells

Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity

doi: 10.3390/cells13201689

Figure Lengend Snippet: Ectopic expression of siRNA-resistant PCIF1 restores the normal levels of target mRNA expression. ( A , B ) RT-qPCR analysis of total RNAs isolated from HeLa cells transfected with a control empty vector (Vec) or a vector expressing siRNA-resistant PCIF1 (PCIF1siR) under treatment with control siRNA (siNC) or PCIF1-targeted siRNAs (siPCIF1 #3), using the specific primer set detecting RAB23 ( A ) and CNOT6 ( B ) expression. The y -axis represents the fold change relative to the levels in HeLa cells treated with control siRNA. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between indicated pairs (Student’s t -test, *** p < 0.001).

Article Snippet: An amount of 1.5 μg of anti-m 6 A antibody (Abcam Limited, Cambridge, UK, ab151230) or normal rabbit IgG (Medical & Biological Laboratories Co.) was incubated with 30 μL of Dynabeads Protein G (Thermo Fisher Scientific) at room temperature for 1 h. Total RNA (50 μg) was added to the antibody-Dynabead complexes and incubated at 4 °C for 4 h. After washing three times, the bound RNA was purified from the beads using SepasolTM-RNA I Super G. The first strand of cDNA was synthesized from m 6 A-RNA using ReverTra AceTM qPCR RT Master Mix with gDNA Remover (Toyobo Co., Osaka, Japan) with random hexamer primers according to the manufacturer’s instructions. cDNA was quantified using GeneAce SYBRTM qPCR Mix II (Nippon Gene Co., Tokyo, Japan) and a Mx3000P real-time PCR system (Agilent).

Techniques: Expressing, Quantitative RT-PCR, Isolation, Transfection, Control, Plasmid Preparation, Standard Deviation

PCIF1 does not regulate expression of its target genes at the transcriptional level. ( A , E ) Schematic illustrations of the RAB23 ( A ) and CNOT6 ( E ) genes. The transcription start sites are indicated by arrows, the exons are shown as black boxes, and the polyadenylation signals are indicated by arrowheads. The positions of the PCR primer set for RT-qPCR amplification of the precursor and mature mRNAs are indicated by arrows. ( B – D , F – H ) RT-qPCR analysis of total RNAs isolated from HeLa cells treated with control siRNA (siNC) and two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #3) using the indicated primer sets. ( I , J ) ChIP analyses of the RAB23 ( I ) and CNOT6 ( J ) gene promoters (position 2 in ) using antibodies against Pol II in HeLa cells treated with control siRNA (siNC) and two distinct PCIF1 targeted siRNAs (siPCIF1 #1 and #3). Normal rabbit IgG was used as the negative control. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between the control siRNA treatment and the indicated PCIF1 targeted siRNA (Student’s t -test, n.s. p > 0.05, *** p < 0.001).

Journal: Cells

Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity

doi: 10.3390/cells13201689

Figure Lengend Snippet: PCIF1 does not regulate expression of its target genes at the transcriptional level. ( A , E ) Schematic illustrations of the RAB23 ( A ) and CNOT6 ( E ) genes. The transcription start sites are indicated by arrows, the exons are shown as black boxes, and the polyadenylation signals are indicated by arrowheads. The positions of the PCR primer set for RT-qPCR amplification of the precursor and mature mRNAs are indicated by arrows. ( B – D , F – H ) RT-qPCR analysis of total RNAs isolated from HeLa cells treated with control siRNA (siNC) and two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #3) using the indicated primer sets. ( I , J ) ChIP analyses of the RAB23 ( I ) and CNOT6 ( J ) gene promoters (position 2 in ) using antibodies against Pol II in HeLa cells treated with control siRNA (siNC) and two distinct PCIF1 targeted siRNAs (siPCIF1 #1 and #3). Normal rabbit IgG was used as the negative control. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between the control siRNA treatment and the indicated PCIF1 targeted siRNA (Student’s t -test, n.s. p > 0.05, *** p < 0.001).

Article Snippet: An amount of 1.5 μg of anti-m 6 A antibody (Abcam Limited, Cambridge, UK, ab151230) or normal rabbit IgG (Medical & Biological Laboratories Co.) was incubated with 30 μL of Dynabeads Protein G (Thermo Fisher Scientific) at room temperature for 1 h. Total RNA (50 μg) was added to the antibody-Dynabead complexes and incubated at 4 °C for 4 h. After washing three times, the bound RNA was purified from the beads using SepasolTM-RNA I Super G. The first strand of cDNA was synthesized from m 6 A-RNA using ReverTra AceTM qPCR RT Master Mix with gDNA Remover (Toyobo Co., Osaka, Japan) with random hexamer primers according to the manufacturer’s instructions. cDNA was quantified using GeneAce SYBRTM qPCR Mix II (Nippon Gene Co., Tokyo, Japan) and a Mx3000P real-time PCR system (Agilent).

Techniques: Expressing, Quantitative RT-PCR, Amplification, Isolation, Control, Negative Control, Standard Deviation

PCIF1 regulates the stability of target gene mRNAs in opposite ways. After HeLa cells were treated with a negative control siRNA (siNC) and two PCIF1-targeted siRNAs (siPCIF1 #1 and #3) for 72 h, actinomycin D was added to inhibit transcription. Cells were harvested at 0, 2, 4, 8, and 12 h after treatment, and total RNA was isolated. The amount of residual mRNA was analyzed by RT-qPCR at each time point, using the specific primer set detecting PCIF1 ( A ), CRAB23 ( B ), and CNOT6 ( C ) mRNAs. The relative value was calculated using the expression level of β-actin mRNA (ACTB) as a normalizer. The relative values at each time point were calculated relative to time zero. Asterisks represent statistically significant differences between the control siRNA treatment and the indicated PCIF1-targeted siRNA (Student’s t -test, * p < 0.05, *** p < 0.001).

Journal: Cells

Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity

doi: 10.3390/cells13201689

Figure Lengend Snippet: PCIF1 regulates the stability of target gene mRNAs in opposite ways. After HeLa cells were treated with a negative control siRNA (siNC) and two PCIF1-targeted siRNAs (siPCIF1 #1 and #3) for 72 h, actinomycin D was added to inhibit transcription. Cells were harvested at 0, 2, 4, 8, and 12 h after treatment, and total RNA was isolated. The amount of residual mRNA was analyzed by RT-qPCR at each time point, using the specific primer set detecting PCIF1 ( A ), CRAB23 ( B ), and CNOT6 ( C ) mRNAs. The relative value was calculated using the expression level of β-actin mRNA (ACTB) as a normalizer. The relative values at each time point were calculated relative to time zero. Asterisks represent statistically significant differences between the control siRNA treatment and the indicated PCIF1-targeted siRNA (Student’s t -test, * p < 0.05, *** p < 0.001).

Article Snippet: An amount of 1.5 μg of anti-m 6 A antibody (Abcam Limited, Cambridge, UK, ab151230) or normal rabbit IgG (Medical & Biological Laboratories Co.) was incubated with 30 μL of Dynabeads Protein G (Thermo Fisher Scientific) at room temperature for 1 h. Total RNA (50 μg) was added to the antibody-Dynabead complexes and incubated at 4 °C for 4 h. After washing three times, the bound RNA was purified from the beads using SepasolTM-RNA I Super G. The first strand of cDNA was synthesized from m 6 A-RNA using ReverTra AceTM qPCR RT Master Mix with gDNA Remover (Toyobo Co., Osaka, Japan) with random hexamer primers according to the manufacturer’s instructions. cDNA was quantified using GeneAce SYBRTM qPCR Mix II (Nippon Gene Co., Tokyo, Japan) and a Mx3000P real-time PCR system (Agilent).

Techniques: Negative Control, Isolation, Quantitative RT-PCR, Expressing, Control

Ectopic expression of siRNA-resistant wild-type but not methyltransferase-deficient mutant PCIF1 restored normal levels of target mRNA expression. ( A ) Immunoblotting analysis of total protein extracts from HeLa cells transfected with a control empty vector (Vec), a vector expressing siRNA-resistant wild-type PCIF1 (siR_wt), or methyltransferase-deficient mutant PCIF1 (siR_mut) under treatment with control siRNA (siNC) or PCIF1-targeted siRNAs (siPCIF1: siPCIF1 #3 was used for PCIF1 suppression) with the indicated antibodies. ( B , C ) RT-qPCR analysis of total RNAs isolated from HeLa cells treated as in ( A ), using the specific primer set detecting RAB23 ( B ) and CNOT6 ( C ) expression. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between the indicated pairs (Student’s t -test, n.s. p > 0.05, * p < 0.05, ** p < 0.01, *** p < 0.001).

Journal: Cells

Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity

doi: 10.3390/cells13201689

Figure Lengend Snippet: Ectopic expression of siRNA-resistant wild-type but not methyltransferase-deficient mutant PCIF1 restored normal levels of target mRNA expression. ( A ) Immunoblotting analysis of total protein extracts from HeLa cells transfected with a control empty vector (Vec), a vector expressing siRNA-resistant wild-type PCIF1 (siR_wt), or methyltransferase-deficient mutant PCIF1 (siR_mut) under treatment with control siRNA (siNC) or PCIF1-targeted siRNAs (siPCIF1: siPCIF1 #3 was used for PCIF1 suppression) with the indicated antibodies. ( B , C ) RT-qPCR analysis of total RNAs isolated from HeLa cells treated as in ( A ), using the specific primer set detecting RAB23 ( B ) and CNOT6 ( C ) expression. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between the indicated pairs (Student’s t -test, n.s. p > 0.05, * p < 0.05, ** p < 0.01, *** p < 0.001).

Article Snippet: An amount of 1.5 μg of anti-m 6 A antibody (Abcam Limited, Cambridge, UK, ab151230) or normal rabbit IgG (Medical & Biological Laboratories Co.) was incubated with 30 μL of Dynabeads Protein G (Thermo Fisher Scientific) at room temperature for 1 h. Total RNA (50 μg) was added to the antibody-Dynabead complexes and incubated at 4 °C for 4 h. After washing three times, the bound RNA was purified from the beads using SepasolTM-RNA I Super G. The first strand of cDNA was synthesized from m 6 A-RNA using ReverTra AceTM qPCR RT Master Mix with gDNA Remover (Toyobo Co., Osaka, Japan) with random hexamer primers according to the manufacturer’s instructions. cDNA was quantified using GeneAce SYBRTM qPCR Mix II (Nippon Gene Co., Tokyo, Japan) and a Mx3000P real-time PCR system (Agilent).

Techniques: Expressing, Mutagenesis, Western Blot, Transfection, Control, Plasmid Preparation, Quantitative RT-PCR, Isolation, Standard Deviation

PCIF1 suppression resulted in a significant decrease in m 6 A levels of both RAB23 and CNOT6 mRNAs. MeRIP-qPCR analysis was performed using HeLa cells treated with control siRNA (siNC) or PCIF1-targeted siRNA (siPCIF1: siPCIF1 #3 was used for PCIF1 suppression). RT-qPCR analysis of RNAs purified from the immunoprecipitates of HeLa cell extracts using the anti-m 6 A antibody, using the specific primer set detecting RAB23 ( A ), CNOT6 ( B ), and ACTB ( C ) mRNAs. The y -axis represents the fold change relative to the RNA levels in the immunoprecipitate by anti-m 6 A antibody from HeLa cells treated with control siRNA (siNC). Normal rabbit IgG (IgG) was used as a negative control. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between the indicated pairs (Student’s t -test, n.s. p > 0.05, *** p < 0.001).

Journal: Cells

Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity

doi: 10.3390/cells13201689

Figure Lengend Snippet: PCIF1 suppression resulted in a significant decrease in m 6 A levels of both RAB23 and CNOT6 mRNAs. MeRIP-qPCR analysis was performed using HeLa cells treated with control siRNA (siNC) or PCIF1-targeted siRNA (siPCIF1: siPCIF1 #3 was used for PCIF1 suppression). RT-qPCR analysis of RNAs purified from the immunoprecipitates of HeLa cell extracts using the anti-m 6 A antibody, using the specific primer set detecting RAB23 ( A ), CNOT6 ( B ), and ACTB ( C ) mRNAs. The y -axis represents the fold change relative to the RNA levels in the immunoprecipitate by anti-m 6 A antibody from HeLa cells treated with control siRNA (siNC). Normal rabbit IgG (IgG) was used as a negative control. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between the indicated pairs (Student’s t -test, n.s. p > 0.05, *** p < 0.001).

Article Snippet: An amount of 1.5 μg of anti-m 6 A antibody (Abcam Limited, Cambridge, UK, ab151230) or normal rabbit IgG (Medical & Biological Laboratories Co.) was incubated with 30 μL of Dynabeads Protein G (Thermo Fisher Scientific) at room temperature for 1 h. Total RNA (50 μg) was added to the antibody-Dynabead complexes and incubated at 4 °C for 4 h. After washing three times, the bound RNA was purified from the beads using SepasolTM-RNA I Super G. The first strand of cDNA was synthesized from m 6 A-RNA using ReverTra AceTM qPCR RT Master Mix with gDNA Remover (Toyobo Co., Osaka, Japan) with random hexamer primers according to the manufacturer’s instructions. cDNA was quantified using GeneAce SYBRTM qPCR Mix II (Nippon Gene Co., Tokyo, Japan) and a Mx3000P real-time PCR system (Agilent).

Techniques: Control, Quantitative RT-PCR, Purification, Negative Control, Standard Deviation

mRNA expression analysis in Nf1 mutant mouse Schwann cells. (A) Microarray analysis was used to compare genome-wide expression levels between normal mouse Schwann cells and Nf1 mutant Schwann cells. The control for each comparison was Cy3-labeled cDNA generated from normal mouse Schwann cell mRNA. For each of four Nf1 mutant Schwann cell samples (Nf1+/−, Nf1−/−, Nf1−/− TXF, and Nf1−/− TXF treated with FTI), mRNA was used as a template to synthesize Cy5-labeled cDNA. Cy3- and Cy5-labeled cDNA probes were hybridized simultaneously to the Incyte Genomics MouseGEM 1.0 cDNA microarray. Relative intensities of Cy3 versus Cy5 fluorescent signals for each cDNA target sequence were analyzed with GeneSpring software. The most changes were observed in the Nf1−/− TXF cells (genes upregulated in Nf1−/− TXF are red; genes downregulated in Nf1−/− TXF are green). Expression of one target cDNA, BLBP (black line), was 26-fold above normal in the Nf1−/− TXF cells and not normalized by FTI treatment. (B) RT-PCR analysis confirmedthe microarray result of elevated BLBP expression in Nf1−/− TXF cells. Reverse transcriptase (RT) was omitted from duplicate samples to control for DNA contamination. Primers for BLBP (∼200-bp amplicon) and actin control primers (∼500-bp amplicon) were included in the mixture for each 40-cycle reaction. The plasmid positive control for BLBP amplification is the UniGEM clone (Incyte Genomics) containing the BLBP cDNA insert spotted on the microarray. (C) Quantitative real-time PCR of BLBP normalized to GAPDH resulted in a 145-fold change over expression in Nf1−/− TXF cells compared to wild-type mouse Schwann cells. Rn, fluorescent signal intensity; horizontal starred line, chosen threshold at geometric phase of amplification.

Journal:

Article Title: Brain Lipid Binding Protein in Axon-Schwann Cell Interactions and Peripheral Nerve Tumorigenesis

doi: 10.1128/MCB.23.6.2213-2224.2003

Figure Lengend Snippet: mRNA expression analysis in Nf1 mutant mouse Schwann cells. (A) Microarray analysis was used to compare genome-wide expression levels between normal mouse Schwann cells and Nf1 mutant Schwann cells. The control for each comparison was Cy3-labeled cDNA generated from normal mouse Schwann cell mRNA. For each of four Nf1 mutant Schwann cell samples (Nf1+/−, Nf1−/−, Nf1−/− TXF, and Nf1−/− TXF treated with FTI), mRNA was used as a template to synthesize Cy5-labeled cDNA. Cy3- and Cy5-labeled cDNA probes were hybridized simultaneously to the Incyte Genomics MouseGEM 1.0 cDNA microarray. Relative intensities of Cy3 versus Cy5 fluorescent signals for each cDNA target sequence were analyzed with GeneSpring software. The most changes were observed in the Nf1−/− TXF cells (genes upregulated in Nf1−/− TXF are red; genes downregulated in Nf1−/− TXF are green). Expression of one target cDNA, BLBP (black line), was 26-fold above normal in the Nf1−/− TXF cells and not normalized by FTI treatment. (B) RT-PCR analysis confirmedthe microarray result of elevated BLBP expression in Nf1−/− TXF cells. Reverse transcriptase (RT) was omitted from duplicate samples to control for DNA contamination. Primers for BLBP (∼200-bp amplicon) and actin control primers (∼500-bp amplicon) were included in the mixture for each 40-cycle reaction. The plasmid positive control for BLBP amplification is the UniGEM clone (Incyte Genomics) containing the BLBP cDNA insert spotted on the microarray. (C) Quantitative real-time PCR of BLBP normalized to GAPDH resulted in a 145-fold change over expression in Nf1−/− TXF cells compared to wild-type mouse Schwann cells. Rn, fluorescent signal intensity; horizontal starred line, chosen threshold at geometric phase of amplification.

Article Snippet: In DRGN cocultures, neurofilament was visualized by incubation with anti-NF-15g1 antibodies ( 38 ) diluted 1:5, followed by donkey anti-mouse Cy3-labeled secondary antibodies (Jackson Immunoresearch).

Techniques: Expressing, Mutagenesis, Microarray, Genome Wide, Labeling, Generated, Sequencing, Software, Reverse Transcription Polymerase Chain Reaction, Amplification, Plasmid Preparation, Positive Control, Real-time Polymerase Chain Reaction, Over Expression

Mouse neuron-Schwann cell coculture. Anti-BLBP promotes extension of Nf1−/− TXF cell processes along axons. Wild-type (A and B) or Nf1−/− TXF (C and D) mouse Schwann cells labeled with Cell Tracker green were preincubated with rabbit IgG (A and C) or anti-BLBP antibodies (B and D) and seeded onto DRGN cultures stripped of endogenous Schwann cells. Two days after seeding, cocultures were fixed and stained with antineurofilament antibodies followed by Cy3 (red)-conjugated secondary antibodies. Confocal images obtained with Zeiss LSM Image Browser software are shown. Single cells are representative of the majority observed with each treatment. Arrowheads indicate Schwann cell processes. The asterisk indicates the region which is magnified fivefold in the inset. The scale bar in panel C equals 5 μm and also applies to panels A, B, and D. (E) Lower magnification (scale bar, 5 μm) of Nf1−/− TXF on DRGN cultures in the presence of anti-BLBP antibodies. Arrowheads indicate processes from two cells extending along neurites; other cells lack processes. (F) Extension of Nf1−/− TXF cell processes in the presence of anti-BLBP antibodies is statistically significant. The percentages of Nf1−/− TXF cells extending processes along axons in the presence of control IgG (gray bar) or anti-BLBP antibodies (black bar) are graphed. Error bars reflect standard deviations in a Student t test (P = 0.003).

Journal:

Article Title: Brain Lipid Binding Protein in Axon-Schwann Cell Interactions and Peripheral Nerve Tumorigenesis

doi: 10.1128/MCB.23.6.2213-2224.2003

Figure Lengend Snippet: Mouse neuron-Schwann cell coculture. Anti-BLBP promotes extension of Nf1−/− TXF cell processes along axons. Wild-type (A and B) or Nf1−/− TXF (C and D) mouse Schwann cells labeled with Cell Tracker green were preincubated with rabbit IgG (A and C) or anti-BLBP antibodies (B and D) and seeded onto DRGN cultures stripped of endogenous Schwann cells. Two days after seeding, cocultures were fixed and stained with antineurofilament antibodies followed by Cy3 (red)-conjugated secondary antibodies. Confocal images obtained with Zeiss LSM Image Browser software are shown. Single cells are representative of the majority observed with each treatment. Arrowheads indicate Schwann cell processes. The asterisk indicates the region which is magnified fivefold in the inset. The scale bar in panel C equals 5 μm and also applies to panels A, B, and D. (E) Lower magnification (scale bar, 5 μm) of Nf1−/− TXF on DRGN cultures in the presence of anti-BLBP antibodies. Arrowheads indicate processes from two cells extending along neurites; other cells lack processes. (F) Extension of Nf1−/− TXF cell processes in the presence of anti-BLBP antibodies is statistically significant. The percentages of Nf1−/− TXF cells extending processes along axons in the presence of control IgG (gray bar) or anti-BLBP antibodies (black bar) are graphed. Error bars reflect standard deviations in a Student t test (P = 0.003).

Article Snippet: In DRGN cocultures, neurofilament was visualized by incubation with anti-NF-15g1 antibodies ( 38 ) diluted 1:5, followed by donkey anti-mouse Cy3-labeled secondary antibodies (Jackson Immunoresearch).

Techniques: Labeling, Staining, Software

( a ) Cell proliferation and ( b ) cell viability alterations of HT-29 and SW480 colorectal cancer cell lines following different folic acid (FA) supplies. Sulforhodamine B (SRB) was used for cell proliferation detection (* p ≤ 0.05, *** p ≤ 0.001), while cell viability data were obtained by alamarBlue assay (** p ≤ 0.01). FA-depleted cells were kept in media containing 0 ng/mL FA, whereas treated cells were exposed to 100 and 10,000 ng/mL FA for 72 h. The percentages of cell proliferation and viability were given relative to samples kept in the normal growth media. FA: folic acid.

Journal: Cancers

Article Title: Folic Acid Treatment Directly Influences the Genetic and Epigenetic Regulation along with the Associated Cellular Maintenance Processes of HT-29 and SW480 Colorectal Cancer Cell Lines

doi: 10.3390/cancers14071820

Figure Lengend Snippet: ( a ) Cell proliferation and ( b ) cell viability alterations of HT-29 and SW480 colorectal cancer cell lines following different folic acid (FA) supplies. Sulforhodamine B (SRB) was used for cell proliferation detection (* p ≤ 0.05, *** p ≤ 0.001), while cell viability data were obtained by alamarBlue assay (** p ≤ 0.01). FA-depleted cells were kept in media containing 0 ng/mL FA, whereas treated cells were exposed to 100 and 10,000 ng/mL FA for 72 h. The percentages of cell proliferation and viability were given relative to samples kept in the normal growth media. FA: folic acid.

Article Snippet: HT-29 (ATCC HTB-39) and SW480 (ATCC CCL-228) human colon adenocarcinoma cell lines were cultured in RPMI 1640 medium (LM-R1641, Biosera, Ringmer, UK) containing 10% fetal bovine serum (Biosera), 80 mg/2 mL gentamycin (Sandoz GmbH, Kundl, Austria), and 2 mM L-glutamine (Biosera).

Techniques: Alamar Blue Assay

Genomic stability detection of HT-29 and SW480 cells exposed to different folic acid (FA) concentrations (0, 100, 10,000 ng/mL). ( a ) Micronucleus (MN) scoring was performed on DAPI- and anti-γ-H2AX-stained slides. Left: We obtained the results by proportioning the cells with MN with all cells counted (** p ≤ 0.01, *** p ≤ 0.001). Right: Representative γ-H2AX-positive micronuclei are indicated with arrows. ( b ) DNA integrity was evaluated with comet assay, additionally. Left: Graphs show the changes in genomic stability in consideration of comet tail DNA percentage (* p ≤ 0.05). Right: Characteristic comets of both cell lines were captured following different treatments. FA: folic acid.

Journal: Cancers

Article Title: Folic Acid Treatment Directly Influences the Genetic and Epigenetic Regulation along with the Associated Cellular Maintenance Processes of HT-29 and SW480 Colorectal Cancer Cell Lines

doi: 10.3390/cancers14071820

Figure Lengend Snippet: Genomic stability detection of HT-29 and SW480 cells exposed to different folic acid (FA) concentrations (0, 100, 10,000 ng/mL). ( a ) Micronucleus (MN) scoring was performed on DAPI- and anti-γ-H2AX-stained slides. Left: We obtained the results by proportioning the cells with MN with all cells counted (** p ≤ 0.01, *** p ≤ 0.001). Right: Representative γ-H2AX-positive micronuclei are indicated with arrows. ( b ) DNA integrity was evaluated with comet assay, additionally. Left: Graphs show the changes in genomic stability in consideration of comet tail DNA percentage (* p ≤ 0.05). Right: Characteristic comets of both cell lines were captured following different treatments. FA: folic acid.

Article Snippet: HT-29 (ATCC HTB-39) and SW480 (ATCC CCL-228) human colon adenocarcinoma cell lines were cultured in RPMI 1640 medium (LM-R1641, Biosera, Ringmer, UK) containing 10% fetal bovine serum (Biosera), 80 mg/2 mL gentamycin (Sandoz GmbH, Kundl, Austria), and 2 mM L-glutamine (Biosera).

Techniques: Staining, Single Cell Gel Electrophoresis

DNA methylation analysis of HT-29 and SW480 cell lines exposed to different folic acid (FA) concentrations. The methylation levels of long interspersed nuclear element 1 (LINE-1) CpG positions (pos 1, pos 2, pos 3) were ( a ) summarized and also ( b ) visualized individually to detect global DNA methylation changes. With the use of Reduced Representation Bisulfite Sequencing (RRBS) method, a genome-wide methylome profile of 10,000 ng/mL FA-treated cells was established in the comparison of cells kept in FA-free (0 ng/mL FA) media. ( c ) Firstly, the number of genes with altered methylation in the investigated CpG sites was assessed. “Hyper” and “hypo” sections indicate the number of genes with methylated and unmethylated CpG sites, respectively. The intersection of these two categories refers to the genes that possess both methylated and unmethylated CpG dinucleotides. ( d ) Heatmap shows the top 10 significantly ( p ≤ 0.05) enriched Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways with the number of differentially methylated genes. ( e ) Pie charts represent the localization of differentially methylated sites (DMS) in distinct chromatin states. FA: folic acid; pos: CpG position; hyper: hypermethylation; hypo: hypomethylation; DMSs: differentially methylated sites; heterochrom/lo: heterochromatin or low signal region; txn: transcription; CNV: copy number variation; KEGG: Kyoto Encyclopedia of Genes and Genomes.

Journal: Cancers

Article Title: Folic Acid Treatment Directly Influences the Genetic and Epigenetic Regulation along with the Associated Cellular Maintenance Processes of HT-29 and SW480 Colorectal Cancer Cell Lines

doi: 10.3390/cancers14071820

Figure Lengend Snippet: DNA methylation analysis of HT-29 and SW480 cell lines exposed to different folic acid (FA) concentrations. The methylation levels of long interspersed nuclear element 1 (LINE-1) CpG positions (pos 1, pos 2, pos 3) were ( a ) summarized and also ( b ) visualized individually to detect global DNA methylation changes. With the use of Reduced Representation Bisulfite Sequencing (RRBS) method, a genome-wide methylome profile of 10,000 ng/mL FA-treated cells was established in the comparison of cells kept in FA-free (0 ng/mL FA) media. ( c ) Firstly, the number of genes with altered methylation in the investigated CpG sites was assessed. “Hyper” and “hypo” sections indicate the number of genes with methylated and unmethylated CpG sites, respectively. The intersection of these two categories refers to the genes that possess both methylated and unmethylated CpG dinucleotides. ( d ) Heatmap shows the top 10 significantly ( p ≤ 0.05) enriched Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways with the number of differentially methylated genes. ( e ) Pie charts represent the localization of differentially methylated sites (DMS) in distinct chromatin states. FA: folic acid; pos: CpG position; hyper: hypermethylation; hypo: hypomethylation; DMSs: differentially methylated sites; heterochrom/lo: heterochromatin or low signal region; txn: transcription; CNV: copy number variation; KEGG: Kyoto Encyclopedia of Genes and Genomes.

Article Snippet: HT-29 (ATCC HTB-39) and SW480 (ATCC CCL-228) human colon adenocarcinoma cell lines were cultured in RPMI 1640 medium (LM-R1641, Biosera, Ringmer, UK) containing 10% fetal bovine serum (Biosera), 80 mg/2 mL gentamycin (Sandoz GmbH, Kundl, Austria), and 2 mM L-glutamine (Biosera).

Techniques: DNA Methylation Assay, Methylation, Methylation Sequencing, Genome Wide, Comparison

Genome-wide transcriptome alterations of HT-29 and SW480 cells following 10,000 ng/mL folic acid (FA) supplementation detected by Human Transcriptome Array 2.0 (HTA 2.0). ( a ) Pie charts represent the proportion of up- and downregulated genes. ( b ) Visual networks of protein–protein interactions were generated by the StringApp of Cytoscape software based on the list of genes with significant ( p ≤ 0.05) expression alterations and ≥|1.5| fold change (FC). Colors refer to the expression level of protein-coding genes (dark blue: FC ≤ −2, light blue: FC ≥ −2 and ≤−1.5, light red: FC ≥ 1.5 and ≤2, dark red: FC ≥ 2). ( c ) Top 10 genes showing significant ( p ≤ 0.05) up- and downregulation visualized with volcano plots. Gray points represent all the transcripts detected by HTA 2.0 microarray, while significantly ( p ≤ 0.05) altering genes with FC ≥ |1.5| value were marked with red and blue. P-val: p -value.

Journal: Cancers

Article Title: Folic Acid Treatment Directly Influences the Genetic and Epigenetic Regulation along with the Associated Cellular Maintenance Processes of HT-29 and SW480 Colorectal Cancer Cell Lines

doi: 10.3390/cancers14071820

Figure Lengend Snippet: Genome-wide transcriptome alterations of HT-29 and SW480 cells following 10,000 ng/mL folic acid (FA) supplementation detected by Human Transcriptome Array 2.0 (HTA 2.0). ( a ) Pie charts represent the proportion of up- and downregulated genes. ( b ) Visual networks of protein–protein interactions were generated by the StringApp of Cytoscape software based on the list of genes with significant ( p ≤ 0.05) expression alterations and ≥|1.5| fold change (FC). Colors refer to the expression level of protein-coding genes (dark blue: FC ≤ −2, light blue: FC ≥ −2 and ≤−1.5, light red: FC ≥ 1.5 and ≤2, dark red: FC ≥ 2). ( c ) Top 10 genes showing significant ( p ≤ 0.05) up- and downregulation visualized with volcano plots. Gray points represent all the transcripts detected by HTA 2.0 microarray, while significantly ( p ≤ 0.05) altering genes with FC ≥ |1.5| value were marked with red and blue. P-val: p -value.

Article Snippet: HT-29 (ATCC HTB-39) and SW480 (ATCC CCL-228) human colon adenocarcinoma cell lines were cultured in RPMI 1640 medium (LM-R1641, Biosera, Ringmer, UK) containing 10% fetal bovine serum (Biosera), 80 mg/2 mL gentamycin (Sandoz GmbH, Kundl, Austria), and 2 mM L-glutamine (Biosera).

Techniques: Genome Wide, Protein-Protein interactions, Generated, Software, Expressing, Microarray

The intersection of genome-wide DNA methylation and gene expression data obtained by Reduced Representation Bisulfite Sequencing (RRBS) and Human Transcriptome Array (HTA) 2.0 analyses. Values represent the methylome and transcriptome pattern changes of 10,000 ng/mL folic acid (FA)-treated HT-29 and SW480 cells compared to non-treated samples (0 ng/mL FA). Only genes with promoter methylation status alteration in accordance with their expression level ( p ≤ 0.05 and fold change ≥|1.5|) were listed (left) and also visualized in volcano plots (right). Gray points represent all the transcripts detected by the microarray, while blue ones highlight down- and red ones show upregulating genes from the list. met. status: DNA methylation status; met. diff.: DNA methylation difference; expr. status: gene expression status; P-val: p -value.

Journal: Cancers

Article Title: Folic Acid Treatment Directly Influences the Genetic and Epigenetic Regulation along with the Associated Cellular Maintenance Processes of HT-29 and SW480 Colorectal Cancer Cell Lines

doi: 10.3390/cancers14071820

Figure Lengend Snippet: The intersection of genome-wide DNA methylation and gene expression data obtained by Reduced Representation Bisulfite Sequencing (RRBS) and Human Transcriptome Array (HTA) 2.0 analyses. Values represent the methylome and transcriptome pattern changes of 10,000 ng/mL folic acid (FA)-treated HT-29 and SW480 cells compared to non-treated samples (0 ng/mL FA). Only genes with promoter methylation status alteration in accordance with their expression level ( p ≤ 0.05 and fold change ≥|1.5|) were listed (left) and also visualized in volcano plots (right). Gray points represent all the transcripts detected by the microarray, while blue ones highlight down- and red ones show upregulating genes from the list. met. status: DNA methylation status; met. diff.: DNA methylation difference; expr. status: gene expression status; P-val: p -value.

Article Snippet: HT-29 (ATCC HTB-39) and SW480 (ATCC CCL-228) human colon adenocarcinoma cell lines were cultured in RPMI 1640 medium (LM-R1641, Biosera, Ringmer, UK) containing 10% fetal bovine serum (Biosera), 80 mg/2 mL gentamycin (Sandoz GmbH, Kundl, Austria), and 2 mM L-glutamine (Biosera).

Techniques: Genome Wide, DNA Methylation Assay, Gene Expression, Methylation Sequencing, Methylation, Expressing, Microarray

Loss of Shh-Brain-Enhancer Proximity during Neuronal Differentiation (A) Map of the Shh regulatory domain showing the genes (black boxes), enhancers (green bars), and fosmid FISH probes (gray boxes). Probe and enhancer coordinates are listed in . (B) Violin plots showing the distribution of inter-probe distances (μm) between Shh and SBE6, SBE4, SBE2/3, ZRS, and CTRL probes in the nuclei of ESCs and D7 NPCs. Distances below the dotted horizontal line at 0.2 μm are considered co-localized. The asterisks on the FISH data represent Mann-Whitney U test significance between ESC and NPC populations. ∗∗ p < 0.01. Each violin plot represents one biological replicate; for other replicates and statistics, see <xref ref-type=Figure S1 and . (C) 3D-SIM images illustrating Shh -SBE6 separation in ESCs or in D7 NPCs. Scales bars are 5 μm (top two rows) and 1 μm (bottom, inset from center row). (D) Shh , Oct4 , and Nestin expression assayed by qRT-PCR during a time course of NPC differentiation. The graph shows mean (±SEM) log2 mRNA levels relative to Gapdh and normalized to the level in ESC (three technical replicates). (E) Violin plots showing Shh -SBE6 inter-probe distances in cell populations corresponding to the expression data in (D). (F) Kernel density plots showing Shh mRNA expression in single NPCs relative to Gapdh and normalized to the expression in ESC. Density is an arbitrary unit based on the frequency of the occurrence and the total counts and the size of the population (i.e., the binning of the data). Data from a biological replicate are shown in Figure S1 B. " width="100%" height="100%">

Journal: Molecular Cell

Article Title: Decreased Enhancer-Promoter Proximity Accompanying Enhancer Activation

doi: 10.1016/j.molcel.2019.07.038

Figure Lengend Snippet: Loss of Shh-Brain-Enhancer Proximity during Neuronal Differentiation (A) Map of the Shh regulatory domain showing the genes (black boxes), enhancers (green bars), and fosmid FISH probes (gray boxes). Probe and enhancer coordinates are listed in . (B) Violin plots showing the distribution of inter-probe distances (μm) between Shh and SBE6, SBE4, SBE2/3, ZRS, and CTRL probes in the nuclei of ESCs and D7 NPCs. Distances below the dotted horizontal line at 0.2 μm are considered co-localized. The asterisks on the FISH data represent Mann-Whitney U test significance between ESC and NPC populations. ∗∗ p < 0.01. Each violin plot represents one biological replicate; for other replicates and statistics, see Figure S1 and . (C) 3D-SIM images illustrating Shh -SBE6 separation in ESCs or in D7 NPCs. Scales bars are 5 μm (top two rows) and 1 μm (bottom, inset from center row). (D) Shh , Oct4 , and Nestin expression assayed by qRT-PCR during a time course of NPC differentiation. The graph shows mean (±SEM) log2 mRNA levels relative to Gapdh and normalized to the level in ESC (three technical replicates). (E) Violin plots showing Shh -SBE6 inter-probe distances in cell populations corresponding to the expression data in (D). (F) Kernel density plots showing Shh mRNA expression in single NPCs relative to Gapdh and normalized to the expression in ESC. Density is an arbitrary unit based on the frequency of the occurrence and the total counts and the size of the population (i.e., the binning of the data). Data from a biological replicate are shown in Figure S1 B.

Article Snippet: Each well of a 96-well PCR plate was loaded with 5 μl 2x Reaction Mix, 0.2 μl Superscript III RT/Platinum Taq Mix with RNaseOUT Ribonuclease Inhibitor (Invitrogen Cells Direct One-Step qRT-PCR kit, Life Technologies), 2.5 μl primer mix (containing 200 nM of each gene-specific primer), 1.3 μl H 2 O. Single-cell suspensions were sorted on their GFP reporter into separate wells of the 96-well PCR plate.

Techniques: MANN-WHITNEY, Expressing, Quantitative RT-PCR

Synthetic Activation of Shh and Increased Enhancer-Promoter Separation Using TALE-VP16 (A) Schematic of TALE-VP64 and TALE-VP128 constructs targeting the Shh promoter (tShh), SBE6, or SBE2. Repeat variable diresidue (RVD) code is displayed with one-letter abbreviations for amino acids. Self-cleaving (2A) peptide allows the expression of eGFP and cell isolation by fluorescence-activated cell sorting (FACS). A map of the targeting sites is shown at right. (B) Log2 mRNA levels of Shh, relative to Gapdh, assayed by qRT-PCR after TALE-VP64/128 expression in ESCs. Data show means (±SEMs) of three biological replicates normalized to ESCs expressing a control eGFP. (C) Violin plots representing one biological replicate of Shh-SBE6 inter-probe distances (μm) in ESCs expressing control eGFP, TALE-VP128 fusions targeting Shh promoter (tShh), SBE6, or SBE2. ∗∗ p < 0.01. Statistical data and replicate experiments are in . Distances below the dotted horizontal line at 0.2 μm are considered co-localized. (D) As in (C), but for VP64 recruitment to both SBE6 and SBE2 simultaneously (tSBE6+2), or a TALE with no fusion protein (tSBE6+2)-Δ. ∗∗ p < 0.01. Representative FISH images with probes for Shh (green) and SBE6 (red) in mESCs expressing tSBE(6+2)-VP64 and tSBE(6+2)-Δ are shown at right. (E) 5C heatmaps of the Shh regulatory region (chr5:28604000-29780000) with 16 kb binning and smoothing for ESCs and for ESCs expressing TALE-VP64 fusions targeting both SBE6 and SBE2. Difference 5C plots are shown above the main 5C plots. (F) Schematic representing TALE-LDB1 targeting sequences. (G) Three-color FISH with probes for Shh (green), SBE6 (magenta), and SBE2 (red) in mESCs expressing tShh-LDB1+tSBE2-LDB1. (H) Violin plots displaying Shh and SBE6 inter-probe distances (μm) in ESCs expressing eGFP or tShh-LDB1+tSBE6-LDB1. ∗∗ p < 0.01. (I) As in (H), but in cells expressing tShh-LDB1+tSBE2-LDB1. Shh-SBE6 distances are shown in the left-hand panel, and Shh-SBE2 distances are in the right-hand panel. ∗∗ p < 0.01. Statistical data relating to this figure are included in .

Journal: Molecular Cell

Article Title: Decreased Enhancer-Promoter Proximity Accompanying Enhancer Activation

doi: 10.1016/j.molcel.2019.07.038

Figure Lengend Snippet: Synthetic Activation of Shh and Increased Enhancer-Promoter Separation Using TALE-VP16 (A) Schematic of TALE-VP64 and TALE-VP128 constructs targeting the Shh promoter (tShh), SBE6, or SBE2. Repeat variable diresidue (RVD) code is displayed with one-letter abbreviations for amino acids. Self-cleaving (2A) peptide allows the expression of eGFP and cell isolation by fluorescence-activated cell sorting (FACS). A map of the targeting sites is shown at right. (B) Log2 mRNA levels of Shh, relative to Gapdh, assayed by qRT-PCR after TALE-VP64/128 expression in ESCs. Data show means (±SEMs) of three biological replicates normalized to ESCs expressing a control eGFP. (C) Violin plots representing one biological replicate of Shh-SBE6 inter-probe distances (μm) in ESCs expressing control eGFP, TALE-VP128 fusions targeting Shh promoter (tShh), SBE6, or SBE2. ∗∗ p < 0.01. Statistical data and replicate experiments are in . Distances below the dotted horizontal line at 0.2 μm are considered co-localized. (D) As in (C), but for VP64 recruitment to both SBE6 and SBE2 simultaneously (tSBE6+2), or a TALE with no fusion protein (tSBE6+2)-Δ. ∗∗ p < 0.01. Representative FISH images with probes for Shh (green) and SBE6 (red) in mESCs expressing tSBE(6+2)-VP64 and tSBE(6+2)-Δ are shown at right. (E) 5C heatmaps of the Shh regulatory region (chr5:28604000-29780000) with 16 kb binning and smoothing for ESCs and for ESCs expressing TALE-VP64 fusions targeting both SBE6 and SBE2. Difference 5C plots are shown above the main 5C plots. (F) Schematic representing TALE-LDB1 targeting sequences. (G) Three-color FISH with probes for Shh (green), SBE6 (magenta), and SBE2 (red) in mESCs expressing tShh-LDB1+tSBE2-LDB1. (H) Violin plots displaying Shh and SBE6 inter-probe distances (μm) in ESCs expressing eGFP or tShh-LDB1+tSBE6-LDB1. ∗∗ p < 0.01. (I) As in (H), but in cells expressing tShh-LDB1+tSBE2-LDB1. Shh-SBE6 distances are shown in the left-hand panel, and Shh-SBE2 distances are in the right-hand panel. ∗∗ p < 0.01. Statistical data relating to this figure are included in .

Article Snippet: Each well of a 96-well PCR plate was loaded with 5 μl 2x Reaction Mix, 0.2 μl Superscript III RT/Platinum Taq Mix with RNaseOUT Ribonuclease Inhibitor (Invitrogen Cells Direct One-Step qRT-PCR kit, Life Technologies), 2.5 μl primer mix (containing 200 nM of each gene-specific primer), 1.3 μl H 2 O. Single-cell suspensions were sorted on their GFP reporter into separate wells of the 96-well PCR plate.

Techniques: Activation Assay, Construct, Expressing, Cell Isolation, Fluorescence, FACS, Quantitative RT-PCR

Journal: Molecular Cell

Article Title: Decreased Enhancer-Promoter Proximity Accompanying Enhancer Activation

doi: 10.1016/j.molcel.2019.07.038

Figure Lengend Snippet:

Article Snippet: Each well of a 96-well PCR plate was loaded with 5 μl 2x Reaction Mix, 0.2 μl Superscript III RT/Platinum Taq Mix with RNaseOUT Ribonuclease Inhibitor (Invitrogen Cells Direct One-Step qRT-PCR kit, Life Technologies), 2.5 μl primer mix (containing 200 nM of each gene-specific primer), 1.3 μl H 2 O. Single-cell suspensions were sorted on their GFP reporter into separate wells of the 96-well PCR plate.

Techniques: Modification, Recombinant, Protease Inhibitor, Transfection, SYBR Green Assay, Staining, Whole Genome Amplification, Purification, Sequencing, Derivative Assay, Multiplex Assay, Software, Imaging, Microarray, Transformation Assay, RNA Sequencing Assay

KEY RESOURCES TABLE

Journal: Cell

Article Title: Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras

doi: 10.1016/j.cell.2017.01.013

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Rabbit polyclonal anti-Tiam1 (C-16) , Santa Cruz , sc-872.

Techniques: Recombinant, Transfection, Adhesive, Sequencing, Cell Viability Assay, Microarray, Expressing, Genome Wide, Illumina Sequencing, CRISPR, Plasmid Preparation, Software

KEY RESOURCES TABLE

Journal: Cell

Article Title: Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras

doi: 10.1016/j.cell.2017.01.013

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Human GM-CSF , Miltenyi Biotec , 130-093-862.

Techniques: Recombinant, Transfection, Adhesive, Sequencing, Cell Viability Assay, Microarray, Expressing, Genome Wide, Illumina Sequencing, CRISPR, Plasmid Preparation, Software

Transcriptional silencing of NSUN5 by promoter CpG island hypermethylation in human glioma cells. a Percentage of NSUN5 methylation in the Sanger panel of cancer cell lines by tumor type. b NSUN5 methylation is associated with loss of the transcript in the glioma cell lines from Sanger ( n = 48). Correlation analysis between methylation beta values and expression Z -score are shown. The P value corresponding to Spearman’s rank correlation test and the associated rho coefficient are indicated in the figure. c Bisulfite genomic sequencing of NSUN5 promoter CpG Island in glioma cells lines and brain white matter. CpG dinucleotides are represented as short vertical lines and the transcription start site (TSS) is represented as a long black arrow. Single clones are shown for each sample. Presence of an unmethylated or methylated cytosine is indicated by a white or black square, respectively, and percentage of methylation is indicated on the right. d DNA methylation profile of the CpG island promoter for the NSUN5 gene analyzed by the 450 K DNA methylation microarray. Single CpG absolute methylation levels (0–1) are shown. Green, unmethylated; red, methylated. Data from the studied six glioma cell lines, brain white matter and nineteen normal brain samples are shown. e NSUN5 expression levels in glioma cell lines determined by real-time PCR (data shown represent mean ± S.D. of biological triplicates) and western blot. f Expression of the NSUN5 RNA transcript and protein was restored in the A172, LN229 and KS-1 cells by treatment with the demethylating drug 5-aza-2′-deoxycytidine (AZA). Data shown represent the mean ± S.D. of biological triplicates and P values were obtained by the Mann–Whitney test. ** P < 0.01

Journal: Acta Neuropathologica

Article Title: Epigenetic loss of RNA-methyltransferase NSUN5 in glioma targets ribosomes to drive a stress adaptive translational program

doi: 10.1007/s00401-019-02062-4

Figure Lengend Snippet: Transcriptional silencing of NSUN5 by promoter CpG island hypermethylation in human glioma cells. a Percentage of NSUN5 methylation in the Sanger panel of cancer cell lines by tumor type. b NSUN5 methylation is associated with loss of the transcript in the glioma cell lines from Sanger ( n = 48). Correlation analysis between methylation beta values and expression Z -score are shown. The P value corresponding to Spearman’s rank correlation test and the associated rho coefficient are indicated in the figure. c Bisulfite genomic sequencing of NSUN5 promoter CpG Island in glioma cells lines and brain white matter. CpG dinucleotides are represented as short vertical lines and the transcription start site (TSS) is represented as a long black arrow. Single clones are shown for each sample. Presence of an unmethylated or methylated cytosine is indicated by a white or black square, respectively, and percentage of methylation is indicated on the right. d DNA methylation profile of the CpG island promoter for the NSUN5 gene analyzed by the 450 K DNA methylation microarray. Single CpG absolute methylation levels (0–1) are shown. Green, unmethylated; red, methylated. Data from the studied six glioma cell lines, brain white matter and nineteen normal brain samples are shown. e NSUN5 expression levels in glioma cell lines determined by real-time PCR (data shown represent mean ± S.D. of biological triplicates) and western blot. f Expression of the NSUN5 RNA transcript and protein was restored in the A172, LN229 and KS-1 cells by treatment with the demethylating drug 5-aza-2′-deoxycytidine (AZA). Data shown represent the mean ± S.D. of biological triplicates and P values were obtained by the Mann–Whitney test. ** P < 0.01

Article Snippet: Human glioma cell lines DBTRG-05MG, M059J, A172, and LN229 were purchased from the American Type Culture Collection; CAS-1 was obtained from The Biological Bank of the IRCCS Azienda Ospedaliera Universitaria San Martino—IST Istituto Nazionale per la Ricerca sul Cancro; and KS-1 was purchased from the Japanese Collection of Research Bioresources Cell Bank.

Techniques: Methylation, Expressing, Genomic Sequencing, Clone Assay, DNA Methylation Assay, Microarray, Real-time Polymerase Chain Reaction, Western Blot, MANN-WHITNEY

Restoration of NSUN5 impairs glioma tumor growth in vivo. a Western blot to show efficient restoration of NSUN5 protein expression upon stable transfection in A172 and LN299 glioma cells and efficient depletion of NSUN5 protein expression in NSUN5-shRNA DBTRG-05MG glioma cells. EV empty vector. An equal number of the indicated A172 and LN299 cells populations were stereotactically inoculated into the brain of athymic mice. The size of the tumors was estimated at 10 and 17 days post-inoculation (DPI) by the quantification of luciferase activity in the tumor cells. b Scatter plots showing the individual size of the indicated LN229 and A172 tumors after 10 and 17 DPI. c Representative images of the luciferase signal from mice inoculated with the indicated LN229 and A172 tumors after 17 DPI. d LN229-EV and LN229-NSUN5 cells were injected in the left or right flank of 10 mice, respectively. Tumor volume measured over time ( left panel ) and tumor weight upon sacrifice ( right panel ) are shown. P values obtained by Student’s t test. Error bars show means ± s.d. e Scramble and NSUN5-shRNA-depleted DBTRG-05MG cells were injected in the left or right flank of 10 mice, respectively. Tumor volume measured over time (left panel) and tumor weight upon sacrifice (right panel) are shown. P values obtained by Student’s t test. Error bars show means ± s.d

Journal: Acta Neuropathologica

Article Title: Epigenetic loss of RNA-methyltransferase NSUN5 in glioma targets ribosomes to drive a stress adaptive translational program

doi: 10.1007/s00401-019-02062-4

Figure Lengend Snippet: Restoration of NSUN5 impairs glioma tumor growth in vivo. a Western blot to show efficient restoration of NSUN5 protein expression upon stable transfection in A172 and LN299 glioma cells and efficient depletion of NSUN5 protein expression in NSUN5-shRNA DBTRG-05MG glioma cells. EV empty vector. An equal number of the indicated A172 and LN299 cells populations were stereotactically inoculated into the brain of athymic mice. The size of the tumors was estimated at 10 and 17 days post-inoculation (DPI) by the quantification of luciferase activity in the tumor cells. b Scatter plots showing the individual size of the indicated LN229 and A172 tumors after 10 and 17 DPI. c Representative images of the luciferase signal from mice inoculated with the indicated LN229 and A172 tumors after 17 DPI. d LN229-EV and LN229-NSUN5 cells were injected in the left or right flank of 10 mice, respectively. Tumor volume measured over time ( left panel ) and tumor weight upon sacrifice ( right panel ) are shown. P values obtained by Student’s t test. Error bars show means ± s.d. e Scramble and NSUN5-shRNA-depleted DBTRG-05MG cells were injected in the left or right flank of 10 mice, respectively. Tumor volume measured over time (left panel) and tumor weight upon sacrifice (right panel) are shown. P values obtained by Student’s t test. Error bars show means ± s.d

Article Snippet: Human glioma cell lines DBTRG-05MG, M059J, A172, and LN229 were purchased from the American Type Culture Collection; CAS-1 was obtained from The Biological Bank of the IRCCS Azienda Ospedaliera Universitaria San Martino—IST Istituto Nazionale per la Ricerca sul Cancro; and KS-1 was purchased from the Japanese Collection of Research Bioresources Cell Bank.

Techniques: In Vivo, Western Blot, Expressing, Stable Transfection, shRNA, Plasmid Preparation, Luciferase, Activity Assay, Injection

NSUN5 epigenetic inactivation abrogates the methylation of the C3782 position of human 28S rRNA. a Top , RNA sequence alignment of the conserved human 28S rRNA C3782 position (black square) in the corresponding 26S, 25S and 28S rRNAs orthologues from C. elegans , S. cerevisiae and M. musculus . Below , Protein sequence alignment of human NSUN5 with its recognized rRNA 5-methylcytosine RNA-methyltransferase orthologues in C. Elegans , S. Cerevisiae and M. musculus . Highlighted in black and grey the identical and physicochemically similar (scoring > 0.5 in the Gonnet PAM 250 matrix) residues, respectively. The aligned region includes the RNA-methyltransferase domain. b NSUN5 interaction with 28S rRNA. Total extracts from LN229 cells, either transfected with empty vector (EV) or NSUN5 were immunoprecipitated with an anti-Flag antibody ( left panel ), followed by analysis of the retrieved RNA by quantitative RT-PCR ( right panel ). c RNA bisulfite sequencing of the 28S rRNA in glioma cells lines according to NSUN5 epigenetic status. Cytosines are represented as short vertical lines and the C3782 site is represented as a long black arrow. Single clones are shown for each sample. Presence of an unmethylated or methylated cytosine is indicated by a white or black square, respectively. d RNA bisulfite sequencing of the 28S rRNA in empty-vector (EV) and NSUN5-transfected LN229 and A172 glioma cells. e RNA bisulfite sequencing of the 28S rRNA in scramble and NSUN5-shRNA-depleted DBTRG-05MG and CAS-1 glioma cells. For CAS-1, western-blot to show efficient NSUN5 depletion is shown above

Journal: Acta Neuropathologica

Article Title: Epigenetic loss of RNA-methyltransferase NSUN5 in glioma targets ribosomes to drive a stress adaptive translational program

doi: 10.1007/s00401-019-02062-4

Figure Lengend Snippet: NSUN5 epigenetic inactivation abrogates the methylation of the C3782 position of human 28S rRNA. a Top , RNA sequence alignment of the conserved human 28S rRNA C3782 position (black square) in the corresponding 26S, 25S and 28S rRNAs orthologues from C. elegans , S. cerevisiae and M. musculus . Below , Protein sequence alignment of human NSUN5 with its recognized rRNA 5-methylcytosine RNA-methyltransferase orthologues in C. Elegans , S. Cerevisiae and M. musculus . Highlighted in black and grey the identical and physicochemically similar (scoring > 0.5 in the Gonnet PAM 250 matrix) residues, respectively. The aligned region includes the RNA-methyltransferase domain. b NSUN5 interaction with 28S rRNA. Total extracts from LN229 cells, either transfected with empty vector (EV) or NSUN5 were immunoprecipitated with an anti-Flag antibody ( left panel ), followed by analysis of the retrieved RNA by quantitative RT-PCR ( right panel ). c RNA bisulfite sequencing of the 28S rRNA in glioma cells lines according to NSUN5 epigenetic status. Cytosines are represented as short vertical lines and the C3782 site is represented as a long black arrow. Single clones are shown for each sample. Presence of an unmethylated or methylated cytosine is indicated by a white or black square, respectively. d RNA bisulfite sequencing of the 28S rRNA in empty-vector (EV) and NSUN5-transfected LN229 and A172 glioma cells. e RNA bisulfite sequencing of the 28S rRNA in scramble and NSUN5-shRNA-depleted DBTRG-05MG and CAS-1 glioma cells. For CAS-1, western-blot to show efficient NSUN5 depletion is shown above

Article Snippet: Human glioma cell lines DBTRG-05MG, M059J, A172, and LN229 were purchased from the American Type Culture Collection; CAS-1 was obtained from The Biological Bank of the IRCCS Azienda Ospedaliera Universitaria San Martino—IST Istituto Nazionale per la Ricerca sul Cancro; and KS-1 was purchased from the Japanese Collection of Research Bioresources Cell Bank.

Techniques: Methylation, Sequencing, Transfection, Plasmid Preparation, Immunoprecipitation, Quantitative RT-PCR, Methylation Sequencing, Clone Assay, shRNA, Western Blot

NSUN5 epigenetic loss is associated with depletion of global protein synthesis and the emergence of a stress-response translational program. a NSUN5 unmethylated glioma cell lines DBTRG-05MG, MO59J, and CAS-1 show higher overall protein synthesis assessed by OP-Puro under oxidative stress (100 mM H 2 O 2 ) than the NSUN5 methylated cells (A172, LN229 and KS-1). b Restoration of NSUN5 function by transfection in epigenetically inactive LN299 cells increases overall protein synthesis under oxidative stress (100 mM H 2 O 2 ) assessed by OP-Puro. Enhancement of global protein synthesis upon NSUN5 recovery in LN299 cells is also observed by the [3H] leucine incorporation assay. c Similar results were obtained upon nutrient deprivation. d Comparison of the total RNA (RNA-seq) and ribosome-protected RNA (Ribo-seq) deep-sequencing profiles to identify those RNAs with enhanced translational efficiency in NSUN5 deficient cells. 1987 RNAs that did not change in the RNA-seq of LN229 cells upon NSUN5-transfection were upregulated in the Ribo-seq of empty-vector-transfected cells indicating enhanced translational efficiency. e NSUN5 affects both CAP-dependent and CAP-independent translation according to the use of a reporter plasmid encoding for Firefly (IRES) and Renilla (CAP) luciferases. f Gene set enrichment analysis (GSEA) of the RNAs with increased translational efficiency in NSUN5 deficient cells (hypergeometric test with a FDR adjusted P value < 0.05)

Journal: Acta Neuropathologica

Article Title: Epigenetic loss of RNA-methyltransferase NSUN5 in glioma targets ribosomes to drive a stress adaptive translational program

doi: 10.1007/s00401-019-02062-4

Figure Lengend Snippet: NSUN5 epigenetic loss is associated with depletion of global protein synthesis and the emergence of a stress-response translational program. a NSUN5 unmethylated glioma cell lines DBTRG-05MG, MO59J, and CAS-1 show higher overall protein synthesis assessed by OP-Puro under oxidative stress (100 mM H 2 O 2 ) than the NSUN5 methylated cells (A172, LN229 and KS-1). b Restoration of NSUN5 function by transfection in epigenetically inactive LN299 cells increases overall protein synthesis under oxidative stress (100 mM H 2 O 2 ) assessed by OP-Puro. Enhancement of global protein synthesis upon NSUN5 recovery in LN299 cells is also observed by the [3H] leucine incorporation assay. c Similar results were obtained upon nutrient deprivation. d Comparison of the total RNA (RNA-seq) and ribosome-protected RNA (Ribo-seq) deep-sequencing profiles to identify those RNAs with enhanced translational efficiency in NSUN5 deficient cells. 1987 RNAs that did not change in the RNA-seq of LN229 cells upon NSUN5-transfection were upregulated in the Ribo-seq of empty-vector-transfected cells indicating enhanced translational efficiency. e NSUN5 affects both CAP-dependent and CAP-independent translation according to the use of a reporter plasmid encoding for Firefly (IRES) and Renilla (CAP) luciferases. f Gene set enrichment analysis (GSEA) of the RNAs with increased translational efficiency in NSUN5 deficient cells (hypergeometric test with a FDR adjusted P value < 0.05)

Article Snippet: Human glioma cell lines DBTRG-05MG, M059J, A172, and LN229 were purchased from the American Type Culture Collection; CAS-1 was obtained from The Biological Bank of the IRCCS Azienda Ospedaliera Universitaria San Martino—IST Istituto Nazionale per la Ricerca sul Cancro; and KS-1 was purchased from the Japanese Collection of Research Bioresources Cell Bank.

Techniques: Methylation, Transfection, Comparison, RNA Sequencing, Sequencing, Plasmid Preparation

NSUN5 epigenetic silencing activates stress-related protein and confers growth inhibition sensitivity to NQO1-targeting molecules. a Validation of NSUN5 translational regulation of the identified stress-related target NQO1 expression at the RNA level determined by RNA-seq counts (left) and real-time quantitative PCR (middle) do not change upon NSUN5 transfection, but NQO1 expression decreased at the protein level (right) upon NSUN5 restoration. b qPCR shows enrichment of the NQO1 transcript in the polysome fraction of the empty-vector LN229 cells in comparison to NSUN5 transfected-LN229 cells. c NQO1 expression levels in glioma cell lines determined by western blot according to NSUN5 methylation status. d IC50 determination using the SRB assay in the glioma cell lines grouped by NSUN5 methylation status. Black dashed curves represent the 95% confidence band for each group. Glioma cells harboring NSUN5 methylation-associated NQO1 overexpression (A172, LN229 and KS-1) show increased sensitivity to deoxynyboquinone (DNQ) and IB-DNQ in comparison to NSUN5 unmethylated cells (DBTRG-05MG, MO59 J, and CAS-1). Drug-response curves were generated using GraphPad Prism software and analyses were performed with the drc R package. For each cell line and the drug, we fit a four-parameter generalized log-logistic model. Comparison of the IC50 values calculated from the slopes were obtained by means of a z test ( P < 0.0001). e IC50 determination using the SRB assay in NSUN5-transfected LN299 cells in comparison with empty-vector-transfected cells (EV) shows enhanced resistance to DNQ-mediated growth inhibition in the cells with restored NSUN5 expression. Comparison of the IC50 values calculated from the slopes was obtained by means of a z test ( P < 0.001). f Kaplan–Meier analysis of Survival according treatment conditions (IB-DNQ treated vs mock group) in a set of mice models with implanted tumors derived from the NSUN5 methylated cell line A172 (left) or the NSUN5 unmethylated cell line DBTRG (right). Significance of the log-rank test is shown. Results of the univariate Cox regression analysis are represented by the hazards ratio (HR) and 95% confidence interval (CI)

Journal: Acta Neuropathologica

Article Title: Epigenetic loss of RNA-methyltransferase NSUN5 in glioma targets ribosomes to drive a stress adaptive translational program

doi: 10.1007/s00401-019-02062-4

Figure Lengend Snippet: NSUN5 epigenetic silencing activates stress-related protein and confers growth inhibition sensitivity to NQO1-targeting molecules. a Validation of NSUN5 translational regulation of the identified stress-related target NQO1 expression at the RNA level determined by RNA-seq counts (left) and real-time quantitative PCR (middle) do not change upon NSUN5 transfection, but NQO1 expression decreased at the protein level (right) upon NSUN5 restoration. b qPCR shows enrichment of the NQO1 transcript in the polysome fraction of the empty-vector LN229 cells in comparison to NSUN5 transfected-LN229 cells. c NQO1 expression levels in glioma cell lines determined by western blot according to NSUN5 methylation status. d IC50 determination using the SRB assay in the glioma cell lines grouped by NSUN5 methylation status. Black dashed curves represent the 95% confidence band for each group. Glioma cells harboring NSUN5 methylation-associated NQO1 overexpression (A172, LN229 and KS-1) show increased sensitivity to deoxynyboquinone (DNQ) and IB-DNQ in comparison to NSUN5 unmethylated cells (DBTRG-05MG, MO59 J, and CAS-1). Drug-response curves were generated using GraphPad Prism software and analyses were performed with the drc R package. For each cell line and the drug, we fit a four-parameter generalized log-logistic model. Comparison of the IC50 values calculated from the slopes were obtained by means of a z test ( P < 0.0001). e IC50 determination using the SRB assay in NSUN5-transfected LN299 cells in comparison with empty-vector-transfected cells (EV) shows enhanced resistance to DNQ-mediated growth inhibition in the cells with restored NSUN5 expression. Comparison of the IC50 values calculated from the slopes was obtained by means of a z test ( P < 0.001). f Kaplan–Meier analysis of Survival according treatment conditions (IB-DNQ treated vs mock group) in a set of mice models with implanted tumors derived from the NSUN5 methylated cell line A172 (left) or the NSUN5 unmethylated cell line DBTRG (right). Significance of the log-rank test is shown. Results of the univariate Cox regression analysis are represented by the hazards ratio (HR) and 95% confidence interval (CI)

Article Snippet: Human glioma cell lines DBTRG-05MG, M059J, A172, and LN229 were purchased from the American Type Culture Collection; CAS-1 was obtained from The Biological Bank of the IRCCS Azienda Ospedaliera Universitaria San Martino—IST Istituto Nazionale per la Ricerca sul Cancro; and KS-1 was purchased from the Japanese Collection of Research Bioresources Cell Bank.

Techniques: Inhibition, Biomarker Discovery, Expressing, RNA Sequencing, Real-time Polymerase Chain Reaction, Transfection, Plasmid Preparation, Comparison, Western Blot, Methylation, Sulforhodamine B Assay, Over Expression, Generated, Software, Derivative Assay

Genome-wide analyses on HIV latency models

Journal: Current HIV/AIDS Reports

Article Title: Bioinformatics and HIV Latency

doi: 10.1007/s11904-014-0240-x

Figure Lengend Snippet: Genome-wide analyses on HIV latency models

Article Snippet: Patient-derived ex vivo model , Integration , DNA shearing (Covaris Adaptive Focused Acoustics) into 300–500-bp fragments End repair (Epicentre End-it DNA End Repair) dA addition (NEB dA-tailing kit) Linker ligation First PCR (LTR-linker) Nested PCR with N6-barcoded primers containing sequencing adapters Illumina sequencing: 2 × 150-bp paired-end (MiSeq) or 2 × 105-bp paired-end (HiSeq) , Trimming: custom Perl scripts Genome alignment: BLAT, hg19 Integration site inclusion criteria for read 1: LTR primer sequence, 5 last bp of the LTR sequence followed with >20-bp DNA sequence with an average quality score >20, mapping to the human genome reference sequence within the first 3 bp and with >95 % identity Integration site inclusion criteria for read 2: alignment to the human genome reference sequence on the opposite strand compared to read 1 and within 1 kb Integration sites are considered different if the breaking point differs from >3 bp Gene ontology analysis: GREAT Statistical analysis: Fisher’s exact test , Maldarelli et al. [ •] .

Techniques: Genome Wide, Ligation, Nested PCR, Clone Assay, Transformation Assay, Sequencing, Two-Dimensional Gel Electrophoresis, Software, Chromatography, Mass Spectrometry, Quantitation Assay, Inverse PCR, Amplification, RNA Extraction, Expressing, Infection, Hybridization, Microarray, Ex Vivo

Key resources table

Journal: iScience

Article Title: Spi1 R235C point mutation confers hypersensitivity to radiation-induced acute myeloid leukemia in mice

doi: 10.1016/j.isci.2023.107530

Figure Lengend Snippet: Key resources table

Article Snippet: 69504 Trans-Blot® Turbo™ Mini PVDF Transfer Packs Bio-Rad Laboratories, Watford, UK Cat. # 1704156 SurePrintG3 Mouse Genome CGH Microarray kit, 4 × 180K Agilent Technologies, Milton Keynes, UK Cat. # G4839-60510 Oligo aCGH/ChIP-on-Chip Hybridisation kit Agilent Technologies, Milton Keynes, UK Cat # 5188-5220 SureTag DNA labelling kit labelling kit Agilent Technologies, Milton Keynes, UK Cat. # 5190-33911 Quanta Exacta kit QuantaBio, MA, USA Cat# 95091-250 Trans-Blot® Turbo™ Mini PVDF Transfer Packs Bio-Rad Laboratories, Watford, UK Cat. # 1704156EDU Experimental models: Cell lines MLP3 mouse rAML cell line Silver et al. 11 N/A Experimental models: Organisms/strains CBA Spm/+ (CBA/Ca Sfpi1/Pu.1 Spm/+ ) This paper National Mouse Archive C57Bl6 Spm/+ (C57Bl6 Sfpi1/Pu.1 Spm/+ ) This paper National Mouse Archive CBA Sfpi1/Pu.1 Gfp/Gfp Nutt et al. 57 National Mouse Archive Oligonucleotides Cel1 F (5’ – GGCAGCAAGAAAAAGATTCG 3′) This paper N/A Cel R (5’ – GGCGACGGGTTAATGCTAT) This paper N/A Spi1 DRU Upper region (R: 5`-Biotinylated-ACCTAAAAA AACCTATATTCCTTCAAC-3`), This paper N/A Spi1 DRU Lower region (F: 5`-AAGGTAGGGTATGGGG ATTAG-3` This paper N/A Spi1 DRU Lower region R: 5`-Biotine-ACCTACTTTACCC TCTATCCA-3`) This paper N/A Spi1 promoter (F: 5`-AGGGTTTATAGGAAGAGTTAAGT-3` This paper N/A Spi1 promoter R: 5`-Biotinylated-AAATAATCCACTATTC TTTTAACCTAA-3`) This paper N/A Spi1 DRU Upper region (R: 5`-Biotinylated-ACCTAAAAA AACCTATATTCCTTCAAC-3`) This paper N/A Spi1 DRU Upper region (5`-TTGTTGTTTGGTAGGT-3`) This paper N/A Spi1 DRU Lower region (5`-GGTATGGGGATTAGG-3`) This paper N/A Spi1 promoter (5`-AAATTTATTTTTAAAATTAGGGA-3`).

Techniques: Blocking Assay, Recombinant, Microarray, Hybridization, Software, Flow Cytometry, Luminex